Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG00906.1 | CBG00906.1 | [unknown] |
Other
14 Allele
Public Name |
---|
WBVar00065178 |
WBVar00065213 |
WBVar00065183 |
WBVar00065218 |
WBVar00065188 |
WBVar00065158 |
WBVar00065223 |
WBVar00065193 |
WBVar00065163 |
WBVar00065198 |
WBVar00065168 |
WBVar00065203 |
WBVar00065173 |
WBVar00065208 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG00906, TCGACAACACGATATGCGAACTGCTGCACGAGGTGAAATCAATGATTCACGGAACAGAAC, WBGene00024221 | Expr1062611 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |