WormMine: Gene WBGene00024225

• WormBase Gene ID: WBGene00024225
• Gene Name: Cbr-let-23
• Sequence Name: CBG00911
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine kinase activity. Is an ortholog of C. elegans let-23. In C. elegans, let-23 is involved in several processes, including determination of adult lifespan; positive regulation of vulval development; and reproductive structure development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00911a.1	CBG00911a.1		[unknown]
Transcript:CBG00911b.1	CBG00911b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00911a	CBG00911a		[unknown]
CDS:CBG00911b	CBG00911b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058512
• Remark: Cbr-let-23, CTACGTCAACCAGCCAATCAGCCAACCAGGATCATCCAACGGTTACTATAACCAGCCAAG, WBGene00024225
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region