WormMine: Gene WBGene00024251

• WormBase Gene ID: WBGene00024251
• Gene Name: CBG00946
• Sequence Name: CBG00946
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine phosphatase activity. Is an ortholog of C. elegans T28F4.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00946.1	CBG00946.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00946	CBG00946		[unknown]

0 RNAi Result

9 Allele

• WBVar00042507
• WBVar00042482
• WBVar00042432
• WBVar00042447
• WBVar00042497
• WBVar00042372
• WBVar00042302
• WBVar00042317
• WBVar00042147

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1055158
• Remark: CBG00946, GTACGCGGATGTGACTCGAAAAGTGACAAAAGCTATCATGGACGAAGAGGAACGGAAACA, WBGene00024251
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region