WormMine: Gene WBGene00024253

• WormBase Gene ID: WBGene00024253
• Gene Name: Cbr-exc-7
• Sequence Name: CBG00948
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be part of ribonucleoprotein complex. Is an ortholog of C. elegans exc-7. In C. elegans, exc-7 is involved in several processes, including epithelial cell development; regulation of alternative mRNA splicing, via spliceosome; and regulation of neuron differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00948a.1	CBG00948a.1		[unknown]
Transcript:CBG00948b.1	CBG00948b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00948a	CBG00948a		[unknown]
CDS:CBG00948b	CBG00948b		[unknown]

0 RNAi Result

4 Allele

• WBVar00043427
• WBVar00043442
• WBVar00043447
• WBVar00043407

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061129
• Remark: Cbr-exc-7, CAAAAATGCAAGGGCTACGCGTTCGTCTCGATGAGCACCTACACAGAGGCCTATAATGCA, WBGene00024253
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region