WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024282 Gene Name  Cbr-smg-8
Sequence Name  ? CBG00981 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Is an ortholog of C. elegans smg-8. In C. elegans, smg-8 is involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00981a.1 CBG00981a.1   [unknown]
Transcript:CBG00981b.1 CBG00981b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00981a CBG00981a   [unknown]
CDS:CBG00981b CBG00981b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-smg-8, GAGAGTACAATTCAGAGCGAATGGGAACGCTCAAGGGTGGATCCATCAAAGTCGTCTACA, WBGene00024282   Expr1066061 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region