WormMine: Gene WBGene00024294

• WormBase Gene ID: WBGene00024294
• Gene Name: Cbr-algn-8
• Sequence Name: CBG00995
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable endonuclease activity and hexosyltransferase activity. Predicted to be involved in DNA repair. Is an ortholog of C. elegans algn-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00995.1	CBG00995.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00995	CBG00995		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069411
• Remark: CBG00995, AGGGATTCCCAGTATTGGAATCGCCAAGAATCTAGCACTTCATGATGTCTATGAAACAGT, WBGene00024294
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region