WormMine: Gene WBGene00024297

• WormBase Gene ID: WBGene00024297
• Gene Name: Cbr-unc-4
• Sequence Name: CBG00998
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans unc-4. In C. elegans, unc-4 is involved in several processes, including negative regulation of canonical Wnt signaling pathway; nervous system development; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00998.1	CBG00998.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00998	CBG00998		[unknown]

0 RNAi Result

1 Allele

• sy5341

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067954
• Remark: Cbr-unc-4, AAATGTGATTCGCGAGAAATCGCCACCACCGGTGCCACAAGCAGCACCAGCCAATCCATT, WBGene00024297
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00042014

0 Upstream Intergenic Region