WormMine: Gene WBGene00024303

• WormBase Gene ID: WBGene00024303
• Gene Name: Cbr-dtmk-1
• Sequence Name: CBG01006
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and thymidylate kinase activity. Predicted to be involved in dTDP biosynthetic process. Is an ortholog of C. elegans dtmk-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01006.1	CBG01006.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01006	CBG01006		[unknown]

0 RNAi Result

14 Allele

• WBVar00141513
• WBVar00141511
• WBVar00141512
• WBVar00066106
• WBVar00066076
• WBVar00066111
• WBVar00066081
• WBVar00066116
• WBVar00066086
• WBVar00066121
• WBVar00066091
• WBVar00066096
• WBVar00066101
• WBVar00066072

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1064972
• Remark: CBG01006, GTGTTCCAGTTGTACACGGAGTTGGATCGCAGCAAGCCACTGGAGGTCTTGGAGAAGATT, WBGene00024303
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region