WormMine: Gene WBGene00024376

• WormBase Gene ID: WBGene00024376
• Gene Name: Cbr-ptr-16
• Sequence Name: CBG01094
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans ptr-16.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01094.1	CBG01094.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01094	CBG01094		[unknown]

0 RNAi Result

24 Allele

• WBVar00048684
• WBVar00048679
• WBVar00048694
• WBVar00048689
• WBVar00048674
• WBVar00048669
• WBVar00066651
• WBVar00066621
• WBVar00066591
• WBVar00066656
• WBVar00066626
• WBVar00066661
• WBVar00066596
• WBVar00066631
• WBVar00066601
• WBVar00066666
• WBVar00066636
• WBVar00066671
• WBVar00066606
• WBVar00066641
• WBVar00066611
• WBVar00066676
• WBVar00066646
• WBVar00066616

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1069633
• Remark: Cbr-ptr-16, CCGGTGACCTGTCTCGATTATTTGGAGGATCGAGTGATTCCAAAATACAACCTGAAAAAA, WBGene00024376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region