Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG01151.1 | CBG01151.1 | [unknown] |
Other
8 Allele
Public Name |
---|
WBVar00067021 |
WBVar00067036 |
WBVar00018734 |
WBVar00018719 |
WBVar00067026 |
WBVar00018724 |
WBVar00067031 |
WBVar00018729 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG01151, GATTTCCGAATTTCTAAATGCAATCGTTCCTGCAACCGGCGTTCACACTATTCGCATACT, WBGene00024426 | Expr1058105 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |