WormMine: Gene WBGene00024521

• WormBase Gene ID: WBGene00024521
• Gene Name: Cbr-cyp-32B1
• Sequence Name: CBG01258
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity; iron ion binding activity; and oxidoreductase activity. Is an ortholog of C. elegans cyp-32B1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01258b.1	CBG01258b.1		[unknown]
Transcript:CBG01258a.1	CBG01258a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01258b	CBG01258b		[unknown]
CDS:CBG01258a	CBG01258a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068332
• Remark: Cbr-cyp-32B1, CAAATATCCTGAAGAACATCCGATTCCAGAGCTCATTCTCAAGCCACAGTTCGGCACACA, WBGene00024521
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region