WormMine: Gene WBGene00024610

• WormBase Gene ID: WBGene00024610
• Gene Name: CBG01357
• Sequence Name: CBG01357
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-201; nhr-202; and nhr-203.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01357c.1	CBG01357c.1		[unknown]
Transcript:CBG01357b.1	CBG01357b.1		[unknown]
Transcript:CBG01357a.1	CBG01357a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01357c	CBG01357c		[unknown]
CDS:CBG01357b	CBG01357b		[unknown]
CDS:CBG01357a	CBG01357a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067150
• Remark: CBG01357, TGCTGGTGACGTATATTGGTGACGAATTTTTAGTTGCTGATTACAAGAAAATGGTTTTCG, WBGene00024610
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region