WormMine: Gene WBGene00024735

• WormBase Gene ID: WBGene00024735
• Gene Name: Cbr-otpl-6
• Sequence Name: CBG01510
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable proton channel activity. Predicted to be involved in proton transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans otpl-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01510.1	CBG01510.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01510	CBG01510		[unknown]

0 RNAi Result

4 Allele

• WBVar00068411
• WBVar00068416
• WBVar00068401
• WBVar00068406

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056044
• Remark: CBG01510, GATTTCACTGTTCAGCTTGTCTTGCGGAAATCTGGAAACATGCGTATTCGACGAAACATA, WBGene00024735
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region