WormMine: Gene WBGene00024756

• WormBase Gene ID: WBGene00024756
• Gene Name: Cbr-glr-5
• Sequence Name: CBG01531
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ligand-gated monoatomic ion channel activity and signaling receptor activity. Predicted to be involved in monoatomic ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans glr-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01531.1	CBG01531.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01531	CBG01531		[unknown]

0 RNAi Result

22 Allele

• WBVar00068621
• WBVar00068636
• WBVar00068606
• WBVar00068641
• WBVar00068611
• WBVar00068626
• WBVar00068631
• WBVar00068616
• WBVar00057604
• WBVar00057599
• WBVar00057589
• WBVar00057594
• WBVar00057584
• WBVar00068581
• WBVar00026149
• WBVar00026154
• WBVar00068586
• WBVar00068591
• WBVar00026159
• WBVar00026164
• WBVar00068596
• WBVar00068601

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056510
• Remark: Cbr-glr-5, TTTGGAATACAGTATGGTACGTGTTGAGTACAATGTTAAAAGGTGGATGTGACTTTGGAC, WBGene00024756
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region