WormMine: Gene WBGene00024782

• WormBase Gene ID: WBGene00024782
• Gene Name: Cbr-pct-1
• Sequence Name: CBG01560
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans pct-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01560b.1	CBG01560b.1		[unknown]
Transcript:CBG01560a.1	CBG01560a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01560a	CBG01560a		[unknown]
CDS:CBG01560b	CBG01560b		[unknown]

0 RNAi Result

1 Allele

• WBVar00141589

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055350
• Remark: Cbr-pct-1, GCACGTGCAAAGTCCGTACCGACGAAAACGTACTCGAACGAAGTGGTTACGCTCTGGTAT, WBGene00024782
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region