WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024783 Gene Name  Cbr-wsp-1
Sequence Name  ? CBG01563 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable actin binding activity. Is an ortholog of C. elegans wsp-1. In C. elegans, wsp-1 is involved in several processes, including embryonic morphogenesis; positive regulation of egg-laying behavior; and regulation of cellular component organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01563a.1 CBG01563a.1   [unknown]
Transcript:CBG01563b.1 CBG01563b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01563a CBG01563a   [unknown]
CDS:CBG01563b CBG01563b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-wsp-1, GAAGAACGGCGTCTGAATATGGGAATCGATGATTCGAGTGATGACGATGAAGAAGAAGAC, WBGene00024783   Expr1054016 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG01565, AGCTACCACACGGAGTAGTCTCATTAGTCAAAGATTATGCACAGAGAGCGTATTTCCTTC, WBGene00024784   Expr1068231 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region