WormMine: Gene WBGene00024787

• WormBase Gene ID: WBGene00024787
• Gene Name: Cbr-klp-19
• Sequence Name: CBG01568
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Is an ortholog of C. elegans klp-19. In C. elegans, klp-19 is involved in meiotic chromosome condensation and meiotic spindle midzone assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01568a.1	CBG01568a.1		[unknown]
Transcript:CBG01568b.1	CBG01568b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01568a	CBG01568a		[unknown]
CDS:CBG01568b	CBG01568b		[unknown]

0 RNAi Result

2 Allele

• WBVar00135836
• WBVar00135837

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1065433
• Remark: Cbr-klp-19, CTCATGCTGTGAATCACATCCGGAAAGAATTGGATCTGGAATTCAAATTGGTCAAGACGG, WBGene00024787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region