WormMine: Gene WBGene00024791

• WormBase Gene ID: WBGene00024791
• Gene Name: Cbr-ocr-2
• Sequence Name: CBG01572
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic ion channel activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans ocr-2. In C. elegans, ocr-2 is involved in heat acclimation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01572.1	CBG01572.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01572	CBG01572		[unknown]

0 RNAi Result

6 Allele

• WBVar00014844
• WBVar00014829
• WBVar00014849
• WBVar00014834
• WBVar00014839
• WBVar00014824

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065092
• Remark: Cbr-ocr-2, GATGTTAGAATTGTCGTTGAGCCCAAAAGAACGCCACCAGTATCTTTTGAAATACTCTCG, WBGene00024791
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region