WormMine: Gene WBGene00024803

• WormBase Gene ID: WBGene00024803
• Gene Name: CBG01586
• Sequence Name: CBG01586
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic cation transmembrane transporter activity. Predicted to be involved in monoatomic cation transport. Is an ortholog of C. elegans K07H8.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01586d.1	CBG01586d.1		[unknown]
Transcript:CBG01586a.1	CBG01586a.1		[unknown]
Transcript:CBG01586b.1	CBG01586b.1		[unknown]
Transcript:CBG01586c.2	CBG01586c.2		[unknown]
Transcript:CBG01586c.1	CBG01586c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01586a	CBG01586a		[unknown]
CDS:CBG01586b	CBG01586b		[unknown]
CDS:CBG01586c	CBG01586c		[unknown]
CDS:CBG01586d	CBG01586d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053677
• Remark: CBG01586, AGACTTTCAACATATTTCCACAAAGCTGCTACTATTGGTGAACTACCCAACGCATGGACA, WBGene00024803
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region