WormMine: Gene WBGene00024841

• WormBase Gene ID: WBGene00024841
• Gene Name: Cbr-gcy-23
• Sequence Name: CBG01631
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-23. In C. elegans, gcy-23 is involved in detection of temperature stimulus; thermosensory behavior; and thermotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01631.1	CBG01631.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01631	CBG01631		[unknown]

0 RNAi Result

10 Allele

• WBVar00043999
• WBVar00043994
• WBVar00069131
• WBVar00069101
• WBVar00069116
• WBVar00069121
• WBVar00069106
• WBVar00069111
• WBVar00069126
• WBVar00069096

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1067392
• Remark: Cbr-gcy-23, GTGAAACAGTCTCAAGCTCGACGTCAAATGGGAGATATTTATGCTTTTGGAATGGTGATG, WBGene00024841
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region