WormMine: Gene WBGene00024900

• WormBase Gene ID: WBGene00024900
• Gene Name: CBG01705
• Sequence Name: CBG01705
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable monoatomic cation transmembrane transporter activity. Predicted to be involved in monoatomic cation transport. Is an ortholog of C. elegans ZK185.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01705a.1	CBG01705a.1		[unknown]
Transcript:CBG01705b.1	CBG01705b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01705b	CBG01705b		[unknown]
CDS:CBG01705a	CBG01705a		[unknown]

0 RNAi Result

2 Allele

• WBVar00069421
• WBVar00069416

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055204
• Remark: CBG01705, AAATCCTTCTTGGGATTTCCATTCCATCCAATATCCTCTTCATTTTTATCATTTTTCTAT, WBGene00024900
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region