WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024926 Gene Name  Cbr-ogdh-1
Sequence Name  ? CBG01737 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor and thiamine pyrophosphate binding activity. Is an ortholog of C. elegans ogdh-1. In C. elegans, ogdh-1 is involved in protein folding. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01737.1 CBG01737.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01737 CBG01737   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_upregulated
  C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01737, AAATTGCACAACACCAGCCAACATCTACCATCTTCTCCGCCGTCAAGTAACCATGCCATT, WBGene00024926   Expr1062802 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region