WormMine: Gene WBGene00024973

• WormBase Gene ID: WBGene00024973
• Gene Name: Cbr-srsx-25
• Sequence Name: CBG01786
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans srsx-25.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01786.1	CBG01786.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01786	CBG01786		[unknown]

0 RNAi Result

8 Allele

• WBVar00044139
• WBVar00044144
• WBVar00044149
• WBVar00069546
• WBVar00069551
• WBVar00069541
• WBVar00069556
• WBVar00069561

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1056676
• Remark: Cbr-srsx-25, TACACGAACAGACTGTGGAAACAGTTAATAGACTTCTGAAATCTCTAACCGTCGTGATTG, WBGene00024973
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region