WormMine: Gene WBGene00025179

• WormBase Gene ID: WBGene00025179
• Gene Name: Cbr-kin-29
• Sequence Name: CBG02036
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans kin-29. In C. elegans, kin-29 is involved in several processes, including dauer entry; positive regulation of growth rate; and transforming growth factor beta receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02036.1	CBG02036.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02036	CBG02036		[unknown]

0 RNAi Result

16 Allele

• WBVar00070336
• WBVar00054244
• WBVar00054239
• WBVar00022299
• WBVar00022269
• WBVar00022304
• WBVar00022274
• WBVar00022309
• WBVar00022279
• WBVar00022249
• WBVar00022284
• WBVar00022254
• WBVar00022289
• WBVar00022259
• WBVar00022294
• WBVar00022264

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054266
• Remark: Cbr-kin-29, GATCGGAGTTGCCGTATTACCTCCAGAGCATAAATCTCACGTGGAATTCGCAATCATCAA, WBGene00025179
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region