WormMine: Gene WBGene00025182

• WormBase Gene ID: WBGene00025182
• Gene Name: Cbr-ssr-2
• Sequence Name: CBG02039
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in signal transduction. Predicted to be located in membrane. Is an ortholog of C. elegans ssr-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02039b.1	CBG02039b.1		[unknown]
Transcript:CBG02039a.1	CBG02039a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02039a	CBG02039a		[unknown]
CDS:CBG02039b	CBG02039b		[unknown]

0 RNAi Result

8 Allele

• WBVar00054264
• WBVar00054259
• WBVar00054254
• WBVar00022349
• WBVar00022334
• WBVar00022339
• WBVar00022344
• WBVar00022329

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069178
• Remark: Cbr-ssr-2, TGAAATCACCACGTCGTGACAAAGAACAAGTCGAGCGGAAGTTGTCGGATGAGCAGCCAA, WBGene00025182
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region