WormMine: Gene WBGene00025432

• WormBase Gene ID: WBGene00025432
• Gene Name: Cbr-gcy-12
• Sequence Name: CBG02368
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-12. In C. elegans, gcy-12 is involved in negative regulation of dauer larval development; regulation of growth; and regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02368a.1	CBG02368a.1		[unknown]
Transcript:CBG02368b.1	CBG02368b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02368b	CBG02368b		[unknown]
CDS:CBG02368a	CBG02368a		[unknown]

0 RNAi Result

1 Allele

• WBVar00135973

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055654
• Remark: Cbr-gcy-12, TGGAAGAGATGGTTACGAATTCACAGAGACAATCGAGGATAAGATGGTTGTGCCAGATAT, WBGene00025432
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region