WormMine: Gene WBGene00025434

• WormBase Gene ID: WBGene00025434
• Gene Name: Cbr-vhp-1
• Sequence Name: CBG02372
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable MAP kinase tyrosine/serine/threonine phosphatase activity. Is an ortholog of C. elegans vhp-1. In C. elegans, vhp-1 is involved in several processes, including negative regulation of MAPK cascade; regulation of defense response to bacterium; and regulation of protein localization to nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02372a.1	CBG02372a.1		[unknown]
Transcript:CBG02372b.1	CBG02372b.1		[unknown]
Transcript:CBG02372c.1	CBG02372c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02372a	CBG02372a		[unknown]
CDS:CBG02372c	CBG02372c		[unknown]
CDS:CBG02372b	CBG02372b		[unknown]

0 RNAi Result

2 Allele

• WBVar00107305
• WBVar00107306

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061331
• Remark: Cbr-vhp-1, GCTTTGATGCTCCAGAAACGAATGTTCCATCTACTCCAATTCTTAACTTCACCAATCCAT, WBGene00025434
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region