WormMine: Gene WBGene00025444

• WormBase Gene ID: WBGene00025444
• Gene Name: Cbr-ccpp-6
• Sequence Name: CBG02382
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metallocarboxypeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans ccpp-6. In C. elegans, ccpp-6 is involved in egg-laying behavior and proteolysis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02382a.1	CBG02382a.1		[unknown]
Transcript:CBG02382b.1	CBG02382b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02382b	CBG02382b		[unknown]
CDS:CBG02382a	CBG02382a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1058317
• Remark: CBG02382, AAAATGATTTTTCTAACAGCTCGAGTTCATCCTGGAGAGTCTCCTAGTAGCCACGTAATG, WBGene00025444
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region