WormMine: Gene WBGene00025464

• WormBase Gene ID: WBGene00025464
• Gene Name: Cbr-clr-1
• Sequence Name: CBG02405
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine phosphatase activity. Is an ortholog of C. elegans clr-1. In C. elegans, clr-1 is involved in several processes, including negative regulation of fibroblast growth factor receptor signaling pathway; netrin-activated signaling pathway; and positive regulation of synapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02405a.1	CBG02405a.1		[unknown]
Transcript:CBG02405b.1	CBG02405b.1		[unknown]
Transcript:CBG02405c.1	CBG02405c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02405c	CBG02405c		[unknown]
CDS:CBG02405a	CBG02405a		[unknown]
CDS:CBG02405b	CBG02405b		[unknown]

0 RNAi Result

14 Allele

• WBVar00107341
• WBVar00107340
• WBVar00107347
• WBVar00107346
• WBVar00107345
• WBVar00107344
• WBVar00107343
• WBVar00107342
• WBVar00107339
• WBVar00107338
• WBVar00107337
• WBVar00107336
• WBVar00107335
• WBVar00107334

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051190
• Remark: Cbr-clr-1, GCTGAGCAACGGATAGACATCTTCCAAACCGTTAAAGGCCTTCAATCACATAGACCGATG, WBGene00025464
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region