WormMine: Gene WBGene00025526

• WormBase Gene ID: WBGene00025526
• Gene Name: Cbr-eif-2D
• Sequence Name: CBG02479
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity and translation initiation factor activity. Predicted to be involved in formation of translation preinitiation complex. Is an ortholog of C. elegans eif-2D.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02479.1	CBG02479.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02479	CBG02479		[unknown]

0 RNAi Result

2 Allele

• WBVar00135978
• WBVar00135979

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058433
• Remark: CBG02479, CTGTGTTCCTGATGGTCGAAAGCTTGACATGAAGAAAACTCGTTTCAAGAAGTTTGCCAC, WBGene00025526
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region