WormMine: Gene WBGene00025552

• WormBase Gene ID: WBGene00025552
• Gene Name: CBG02509
• Sequence Name: CBG02509
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable SUMO transferase activity and zinc ion binding activity. Predicted to be involved in double-strand break repair via homologous recombination. Predicted to be part of Smc5-Smc6 complex. Is an ortholog of C. elegans ZK1248.11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02509b.1	CBG02509b.1		[unknown]
Transcript:CBG02509a.1	CBG02509a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02509b	CBG02509b		[unknown]
CDS:CBG02509a	CBG02509a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055151
• Remark: CBG02509, CTCAAACAATCACCATCTCTCGTCTCGAGGACTATCCCGACTACTGGAACAATATAAAAC, WBGene00025552
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region