WormMine: Gene WBGene00025572

• WormBase Gene ID: WBGene00025572
• Gene Name: Cbr-vps-35
• Sequence Name: CBG02534
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in protein transport and retrograde transport, endosome to Golgi. Predicted to be part of retromer, cargo-selective complex. Is an ortholog of C. elegans vps-35. In C. elegans, vps-35 is involved in positive regulation of protein localization to cell periphery; protein localization to postsynaptic membrane; and regulation of presynapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02534.1	CBG02534.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02534	CBG02534		[unknown]

0 RNAi Result

2 Allele

• WBVar00107443
• WBVar00107442

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065687
• Remark: Cbr-vps-35, TGTTCAACTGGACGTCTCTGCTGAAGCTGATAATCTAGAGAAGCAACTTGGAGAAACGAT, WBGene00025572
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region