WormMine: Gene WBGene00025619

• WormBase Gene ID: WBGene00025619
• Gene Name: Cbr-daf-37
• Sequence Name: CBG02594
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled peptide receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans daf-37. In C. elegans, daf-37 is involved in G protein-coupled receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02594b.1	CBG02594b.1		[unknown]
Transcript:CBG02594a.1	CBG02594a.1		[unknown]
Transcript:CBG02594c.1	CBG02594c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02594b	CBG02594b		[unknown]
CDS:CBG02594c	CBG02594c		[unknown]
CDS:CBG02594a	CBG02594a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069627
• Remark: CBG02594, CTGGAAAGACTGGAACAGACGAGATTTTTAGCACATCATGAAGATGGTGTACACACTCAG, WBGene00025619
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region