WormMine: Gene WBGene00025630

• WormBase Gene ID: WBGene00025630
• Gene Name: Cbr-nmgp-1
• Sequence Name: CBG02608
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans nmgp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02608a.1	CBG02608a.1		[unknown]
Transcript:CBG02608c.1	CBG02608c.1		[unknown]
Transcript:CBG02608b.1	CBG02608b.1		[unknown]
Transcript:CBG02608d.1	CBG02608d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02608d	CBG02608d		[unknown]
CDS:CBG02608b	CBG02608b		[unknown]
CDS:CBG02608c	CBG02608c		[unknown]
CDS:CBG02608a	CBG02608a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061977
• Remark: Cbr-nmgp-1, GACAAGCCGAGCACATGTCCGACTCAATCAGCCAATTTGATTATCGCAGGGATAAACGAC, WBGene00025630
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region