WormMine: Gene WBGene00025646

• WormBase Gene ID: WBGene00025646
• Gene Name: Cbr-sma-6
• Sequence Name: CBG02627
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and transmembrane receptor protein serine/threonine kinase activity. Predicted to be involved in cell surface receptor protein serine/threonine kinase signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans sma-6. In C. elegans, sma-6 is involved in several processes, including defense response to other organism; nematode male tail tip morphogenesis; and positive regulation of macromolecule metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02627.1	CBG02627.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02627	CBG02627		[unknown]

0 RNAi Result

1 Allele

• sy5148

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059689
• Remark: Cbr-sma-6, GATGGAATTGTACACAACGATCCAAGTTTTGATGACATGAGAGAAGTAGTTTACGTTCGG, WBGene00025646
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region