WormMine: Gene WBGene00025656

• WormBase Gene ID: WBGene00025656
• Gene Name: CBG02637
• Sequence Name: CBG02637
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein folding chaperone. Predicted to be involved in protein insertion into ER membrane. Predicted to be located in endoplasmic reticulum membrane. Is an ortholog of C. elegans K10B2.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02637.1	CBG02637.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02637	CBG02637		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057130
• Remark: CBG02637, GATGAGCTACCTCCAGAATCCATCGCCAATCATTCCTCCATGGGTTACCCTTCTTCAATC, WBGene00025656
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region