WormMine: Gene WBGene00025698

• WormBase Gene ID: WBGene00025698
• Gene Name: Cbr-wrn-1
• Sequence Name: CBG02689
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 3'-5' DNA helicase activity; ATP binding activity; and nucleic acid binding activity. Predicted to be involved in DNA recombination; DNA repair; and DNA replication. Is an ortholog of C. elegans wrn-1. In C. elegans, wrn-1 is involved in DNA metabolic process; determination of adult lifespan; and response to ionizing radiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02689.1	CBG02689.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02689	CBG02689		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063917
• Remark: Cbr-wrn-1, AAGCACGCGGTATCAGTGAGGGTACTGTCTACAATTATCTAGTGATTGCTGTTGAAAAGG, WBGene00025698
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

9 GO Annotation

0 Homologues

0 Locations

9 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region