WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025707 Gene Name  Cbr-puf-2
Sequence Name  ? CBG02702 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable RNA binding activity. Expressed in anchor cell; pm7; and vulval cell. Is an ortholog of C. elegans fbf-1 and fbf-2. In C. elegans, fbf-1 is involved in several processes, including germline cell cycle switching, mitotic to meiotic cell cycle; olfactory learning; and regulation of gene expression. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02702.1 CBG02702.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02702 CBG02702   [unknown]

0 RNAi Result

5 Allele

Public Name
WBVar00035234
WBVar00107866
WBVar00107865
WBVar00107873
WBVar00107867

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02702, TTCTGGCAAGAAGATCCTAGACATACTTCAAAGCATGGAAGGCTACGTACCAACCGCCAC, WBGene00025707   Expr1062018 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr11516 The developmental profiles of Cbr-puf-2 and Cbr-puf-1.2 mRNA levels are qualitatively similar and are typical of germ line-expressed genes: low expression from embryo to L2 stages, slightly increasing expression at L3 and L4, and peak levels in adults. However, Cbr-puf-2 is over 100-fold more abundant than Cbr-puf-1.2.  
    Expr11436 Cbr-puf-2 is expressed in the pharyngeal muscle 7. The GFP signal could only be detected during a brief window from the late fourfold embryo to the early second larval stage. Cbr-puf-2 reporter expression is also seen in four vulval muscle (vm) cells starting in L4. It is expressed in the anchor cell and vulval muscles, but not in the vulva precursor cells (VPCs) themselves.  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region