WormMine: Gene WBGene00025741

• WormBase Gene ID: WBGene00025741
• Gene Name: Cbr-npp-3
• Sequence Name: CBG02744
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be part of nuclear pore. Is an ortholog of C. elegans npp-3. In C. elegans, npp-3 is involved in several processes, including establishment of localization in cell; positive regulation of nematode male tail tip morphogenesis; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02744a.1	CBG02744a.1		[unknown]
Transcript:CBG02744b.1	CBG02744b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02744b	CBG02744b		[unknown]
CDS:CBG02744a	CBG02744a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065224
• Remark: Cbr-npp-3, AGAAGTCAACGCAAGTCTCTTATCGGAAAGTGCCAGCGAACGAATCGTATCTGGATGTAC, WBGene00025741
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region