Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02852.1 | CBG02852.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00107811 |
| WBVar00107810 |
| WBVar00107808 |
| WBVar00107807 |
| WBVar00107806 |
| WBVar00107805 |
| WBVar00107804 |
| WBVar00107803 |
| WBVar00107809 |
| WBVar00107815 |
| WBVar00107814 |
| WBVar00107813 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG02852, TTCGCCTTTTGACTGGGAACTATCGGGGCAATCTGAACTGGAGAAAACGATTAAACAACC, WBGene00025822 | Expr1051845 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
