WormMine: Gene WBGene00025843

• WormBase Gene ID: WBGene00025843
• Gene Name: CBG02874
• Sequence Name: CBG02874
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable catalytic activity; magnesium ion binding activity; and thiamine pyrophosphate binding activity. Is an ortholog of C. elegans hacl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02874.1	CBG02874.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02874	CBG02874		[unknown]

0 RNAi Result

1 Allele

• WBVar00141798

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1062408
• Remark: CBG02874, CAGAAATTAAGGCTGCCCTTGAGAAGGCTTTCCAAAAGACCGACGGACCAACTGTTATCA, WBGene00025843
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region