WormMine: Gene WBGene00025861

• WormBase Gene ID: WBGene00025861
• Gene Name: Cbr-vha-6
• Sequence Name: CBG02894
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of vacuolar proton-transporting V-type ATPase, V0 domain. Is an ortholog of C. elegans vha-6. In C. elegans, vha-6 is involved in nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02894.1	CBG02894.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02894	CBG02894		[unknown]

0 RNAi Result

23 Allele

• WBVar00107864
• WBVar00107863
• WBVar00107862
• WBVar00107861
• WBVar00107860
• WBVar00107859
• WBVar00107858
• WBVar00107857
• WBVar00107856
• WBVar00107877
• WBVar00107876
• WBVar00107875
• WBVar00107874
• WBVar00107872
• WBVar00107871
• WBVar00107870
• WBVar00107869
• WBVar00107868
• WBVar00107855
• WBVar00107854
• WBVar00107853
• WBVar00107852
• WBVar00107851

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063905
• Remark: Cbr-vha-6, AATTCGTCTTCATTGGGTCGAGTTCCAATCGAAATTCTACGGCGGAACTGGAATTCAATT, WBGene00025861
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region