WormMine: Gene WBGene00025889

• WormBase Gene ID: WBGene00025889
• Gene Name: Cbr-rsf-1
• Sequence Name: CBG02930
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans rsf-1. In C. elegans, rsf-1 is involved in several processes, including chromosome condensation; positive regulation of response to oxidative stress; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02930b.1	CBG02930b.1		[unknown]
Transcript:CBG02930a.1	CBG02930a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02930a	CBG02930a		[unknown]
CDS:CBG02930b	CBG02930b		[unknown]

0 RNAi Result

3 Allele

• WBVar00136011
• WBVar00136012
• WBVar00136013

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050534
• Remark: CBG02930, TTCTCATCCAAAAACTCATTCACCCTTCCAAAATCATTCTCTCCAGTAGACAGCATTCGA, WBGene00025889
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region