WormMine: Gene WBGene00025926

• WormBase Gene ID: WBGene00025926
• Gene Name: Cbr-nuo-1
• Sequence Name: CBG02970
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity; FMN binding activity; and NAD binding activity. Is an ortholog of C. elegans nuo-1. In C. elegans, nuo-1 is involved in several processes, including dauer exit; determination of adult lifespan; and inductive cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02970.1	CBG02970.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02970	CBG02970		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062321
• Remark: Cbr-nuo-1, CGACCTGAACTCGAACGTAGAATGGCAGAGTTCCACAAGCAAGTTTTGGCTGAACAAGGA, WBGene00025926
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region