WormMine: Gene WBGene00025929

• WormBase Gene ID: WBGene00025929
• Gene Name: Cbr-unc-53
• Sequence Name: CBG02975
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in neurogenesis. Is an ortholog of C. elegans unc-53. In C. elegans, unc-53 is involved in several processes, including backward locomotion; positive regulation of locomotion; and reproductive behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02975b.1	CBG02975b.1		[unknown]
Transcript:CBG02975c.1	CBG02975c.1		[unknown]
Transcript:CBG02975a.1	CBG02975a.1		[unknown]
Transcript:CBG02975e.1	CBG02975e.1		[unknown]
Transcript:CBG02975d.1	CBG02975d.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02975a	CBG02975a		[unknown]
CDS:CBG02975b	CBG02975b		[unknown]
CDS:CBG02975c	CBG02975c		[unknown]
CDS:CBG02975d	CBG02975d		[unknown]
CDS:CBG02975e	CBG02975e		[unknown]

0 RNAi Result

9 Allele

• WBVar00107943
• WBVar00107951
• WBVar00107950
• WBVar00107949
• WBVar00107948
• WBVar00107947
• WBVar00107946
• WBVar00107945
• WBVar00107944

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055055
• Remark: Cbr-unc-53, GAAGACCCAACTGACATTGTCACCGAAAAATGGCCATGGTTCGATGGTCCAAATCCAGAA, WBGene00025929
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region