WormMine: Gene WBGene00025950

• WormBase Gene ID: WBGene00025950
• Gene Name: CBG03003
• Sequence Name: CBG03003
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nucleotide binding activity. Predicted to be involved in transcription initiation at RNA polymerase III promoter. Predicted to be part of RNA polymerase III complex. Is an ortholog of C. elegans M106.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03003a.1	CBG03003a.1		[unknown]
Transcript:CBG03003b.1	CBG03003b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03003b	CBG03003b		[unknown]
CDS:CBG03003a	CBG03003a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067463
• Remark: CBG03003, AAGAGGAACTCGAGAAGCTTATCACAACAATCACTGACTGTCTGCCACCTCCACCAAAAC, WBGene00025950
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region