WormMine: Gene WBGene00025958

• WormBase Gene ID: WBGene00025958
• Gene Name: Cbr-ect-2
• Sequence Name: CBG03012
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTPase activator activity and guanyl-nucleotide exchange factor activity. Predicted to be involved in regulation of cytokinesis, actomyosin contractile ring assembly. Predicted to be located in cytoplasm and nucleus. Is an ortholog of C. elegans ect-2. In C. elegans, ect-2 is involved in several processes, including asymmetric protein localization involved in cell fate determination; mitotic cytokinesis; and regulation of actin filament-based process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03012a.1	CBG03012a.1		[unknown]
Transcript:CBG03012b.1	CBG03012b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03012a	CBG03012a		[unknown]
CDS:CBG03012b	CBG03012b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1052064
• Remark: Cbr-ect-2, AAGGAGAGTAATCCGGAGTTTCATAGACTGAAACTGACTGATTTGATGGTGAAACCAGTT, WBGene00025958
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region