WormMine: Gene WBGene00026144

• WormBase Gene ID: WBGene00026144
• Gene Name: CBG03250
• Sequence Name: CBG03250
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transferase activity, transferring alkyl or aryl (other than methyl) groups. Predicted to be involved in dolichol biosynthetic process. Predicted to be part of dehydrodolichyl diphosphate synthase complex. Is an ortholog of C. elegans F37B12.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03250.1	CBG03250.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03250	CBG03250		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070052
• Remark: CBG03250, TCGGGTCTCGAAAACATTAGAAGACAAATTCCACCTTAGTGATCCAGATTTTCTACTTCA, WBGene00026144
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region