WormMine: Gene WBGene00026150

• WormBase Gene ID: WBGene00026150
• Gene Name: CBG03256
• Sequence Name: CBG03256
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable actin binding activity. Is an ortholog of C. elegans T24B8.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03256c.1	CBG03256c.1		[unknown]
Transcript:CBG03256b.1	CBG03256b.1		[unknown]
Transcript:CBG03256a.2	CBG03256a.2		[unknown]
Transcript:CBG03256a.1	CBG03256a.1		[unknown]
Transcript:CBG03256a.3	CBG03256a.3		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03256c	CBG03256c		[unknown]
CDS:CBG03256b	CBG03256b		[unknown]
CDS:CBG03256a	CBG03256a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052550
• Remark: CBG03256, AATATCTCAATTATATAATTTACAGATCTCGTTCGACGAATTCACGGTACCCCATCCATC, WBGene00026150
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region