WormMine: Gene WBGene00026154

• WormBase Gene ID: WBGene00026154
• Gene Name: Cbr-clh-5
• Sequence Name: CBG03262
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable voltage-gated chloride channel activity. Predicted to be involved in chloride transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans clh-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03262.1	CBG03262.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03262	CBG03262		[unknown]

0 RNAi Result

18 Allele

• WBVar00108218
• WBVar00108217
• WBVar00108221
• WBVar00108220
• WBVar00108229
• WBVar00108228
• WBVar00108227
• WBVar00108226
• WBVar00108225
• WBVar00108224
• WBVar00108223
• WBVar00108222
• WBVar00108219
• WBVar00108232
• WBVar00108231
• WBVar00108230
• WBVar00108234
• WBVar00108233

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062470
• Remark: Cbr-clh-5, AAATTGGAAAAGATTGTGTCATGCCTGGTTTGTATGCTATGGTTGGAGCAGCTGCAGTTC, WBGene00026154
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region